Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05830

HP ID(1) HP05830
Gene ID(2) 84310
Gene Symbol finder C7orf50
Protein Name chromosome 7 open reading frame 50
RefSeq NM_032350.5
Length of RefSeq (bp) 1311
Chromosome 7p22.3
Reference DDBJ accession
UniGene Hs.653258

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe94B12 pKA1U5 GACCTGGGGCGCGGGTCCCTGCCGGAAGGCGGCGTCCGCGACGCAGCTGTTCACGCTTAG
RBb24A07 pGCAP1 TGGCGTCCGCGACGCAGCTGTTCACGCTTAGGTGGGCGACGTGGGCGCAGGTGGGCGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl