Prev. | 

RIKEN DNA Bank Human Resource - C7orf50

Gene ID NCBI Gene 84310 |  KEGG hsa:84310
Gene Symbol C7orf50
Protein Name chromosome 7 open reading frame 50
Synonyms YCR016W
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086203 IRAL015I11 pOTB7 BC006224 NM_032350 Full
HGY097081 IRAL042L17 pOTB7 BC025971 NM_032350 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098445 M01C046B21 pDONR221 MGC12-G11 BC006224 NM_032350  
HGE098493 M01C046D21 pDONR221 MGC12-G11 BC006224 NM_032350  
HGE098541 M01C046F21 pDONR221 MGC12-G11 BC006224 NM_032350  
HGE098589 M01C046H21 pDONR221 MGC12-G11 BC006224 NM_032350  
HGE098637 M01C046J21 pDONR221 MGC12-G11 BC006224 NM_032350  
HGE098685 M01C046L21 pDONR221 MGC12-G11 BC006224 NM_032350  
HGE098733 M01C046N21 pDONR221 MGC12-G11 BC006224 NM_032350  
HGE098781 M01C046P21 pDONR221 MGC12-G11 BC006224 NM_032350  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR077636 ARe94B12 pKA1U5 NM_032350.5  
GACCTGGGGCGCGGGTCCCTGCCGGAAGGCGGCGTCCGCGACGCAGCTGTTCACGCTTAG
HKR329607 RBb24A07 pGCAP1 NM_032350.5  
TGGCGTCCGCGACGCAGCTGTTCACGCTTAGGTGGGCGACGTGGGCGCAGGTGGGCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl