Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05819

HP ID(1) HP05819
Gene ID(2) 9238
Gene Symbol finder TBRG4
Protein Name transforming growth factor beta regulator 4
RefSeq NM_004749.2
Length of RefSeq (bp) 2299
Chromosome 7p14-p13
Reference DDBJ accession
UniGene Hs.231411

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi79B11 pGCAP10 GGGCGGATGGAGGTCAGCGGTGGTGCTCGCTGCGGTTTGGAATCACTTGCTAGGAGTCTT
RBd34H06 pGCAP10 GGAGTGACGTAGGGAAGCGCGCCGCGCACCTCATGGTTCCGGGGACAGTTAGGGCGGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl