Prev. | 

RIKEN DNA Bank Human Resource - TBRG4

Gene ID NCBI Gene 9238 |  KEGG hsa:9238
Gene Symbol TBRG4
Protein Name transforming growth factor beta regulator 4
Synonyms CPR2|FASTKD4
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006009 IRAK015A09 pCMV-SPORT6 BC014918 NM_004749 Full
HGY084964 IRAL012G20 pOTB7 BC002732 NM_004749 Partial
HGY090905 IRAL027E09 pOTB7 BC017235 NM_004749 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR191635 ARi79B11 pGCAP10 NM_004749.2  
GGGCGGATGGAGGTCAGCGGTGGTGCTCGCTGCGGTTTGGAATCACTTGCTAGGAGTCTT
HKR373774 RBd34H06 pGCAP10 NM_004749.2  
GGAGTGACGTAGGGAAGCGCGCCGCGCACCTCATGGTTCCGGGGACAGTTAGGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl