Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05815

HP ID(1) HP05815
Gene ID(2) 9061
Gene Symbol finder PAPSS1
Protein Name 3'-phosphoadenosine 5'-phosphosulfate synthase 1
RefSeq NM_005443.4
Length of RefSeq (bp) 2558
Chromosome 4q24
Reference DDBJ accession
UniGene Hs.368610

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi31E04 pGCAP10 GAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCCTGTGCAAGAAAGTCAAGCTGAGCA
ARi66C07 pGCAP10 GGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCCTGTG
RBd46B01 pGCAP10 GGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTG
RBd81F01 pGCAP10 GAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTGCAAGAA
RBdS051B16 pGCAP10 GGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTGCAAGAAAGTCAAGCTG
RBdS070J24 pGCAP10 GAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTGCA
RBdS104G13 pGCAP10 GGCTACCCTCCCGGCGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATC
RBdS104M24 pGCAP10 GGCTACCCTCCCGGCGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl