Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PAPSS1

Gene ID (NCBI) 9061
Gene Symbol PAPSS1
Protein Name 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Synonyms ATPSK1|PAPSS|SK1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005410 IRAK013I18 pCMV-SPORT6 BC011392 NM_005443 Partial
HGX033906 IRAK084M18 pCMV-SPORT6 BC040940 NM_005443 Full
HGX044116 IRAK110E20 pCMV-SPORT6 BC050627 NM_005443 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172500 ARi31E04 pGCAP10 NM_005443.4  
GAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCCTGTGCAAGAAAGTCAAGCTGAGCA
HKR186455 ARi66C07 pGCAP10 NM_005443.4  
GGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCCTGTG
HKR378425 RBd46B01 pGCAP10 NM_005443.4  
GGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTG
HKR392521 RBd81F01 pGCAP10 NM_005443.4  
GAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTGCAAGAA
HKR420440 RBdS051B16 pGCAP10 NM_005443.4  
GGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTGCAAGAAAGTCAAGCTG
HKR428240 RBdS070J24 pGCAP10 NM_005443.4  
GAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATCCCCGGGAGCTTGTGCA
HKR441757 RBdS104G13 pGCAP10 NM_005443.4  
GGCTACCCTCCCGGCGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATC
HKR441912 RBdS104M24 pGCAP10 NM_005443.4  
GGCTACCCTCCCGGCGCAGAGAACCCCGGCTGCTCAGCGCGCTCCGCGGTCATGGAGATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl