Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05813

HP ID(1) HP05813
Gene ID(2) 65110
Gene Symbol finder UPF3A
Protein Name UPF3 regulator of nonsense transcripts homolog A (yeast)
RefSeq NM_023011.2
Length of RefSeq (bp) 2381
Chromosome 13q34
Reference DDBJ accession
UniGene Hs.533855

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi10G08 pGCAP10 GGCTGGCGGCTGCGGCTCGGCGGAGAGTGCGGCATGCGCTCGGAAAAGGAGGGGGCCGGA
RBb50H09 pGCAP1 ATGCGCTCGGAAAAGGAGGGGGCCGGAAGGCCTTCGGGCGGCCGTTGCCGCGCGGGGCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl