Prev. |  KEGG KO K14328 > 

RIKEN DNA Bank Human Resource - UPF3A

Gene ID NCBI Gene 65110 |  KEGG hsa:65110
Gene Symbol UPF3A
Protein Name UPF3A regulator of nonsense mediated mRNA decay
Synonyms HUPF3A|RENT3A|UPF3
Ortholog resources KEGG ortholog (KEGG orthology K14328) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092026 IRAL030B02 pOTB7 BC023569 NM_080687 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE032030 W01A080B06 pENTR-TOPO IRAL030B02 BC023569 NM_080687  
HGE032032 W01A080B08 pENTR-TOPO IRAL030B02 BC023569 NM_080687  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164152 ARi10G08 pGCAP10 NM_023011.2  
GGCTGGCGGCTGCGGCTCGGCGGAGAGTGCGGCATGCGCTCGGAAAAGGAGGGGGCCGGA
HKR340177 RBb50H09 pGCAP1 NM_023011.2  
ATGCGCTCGGAAAAGGAGGGGGCCGGAAGGCCTTCGGGCGGCCGTTGCCGCGCGGGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl