Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05796

HP ID(1) HP05796
Gene ID(2) 84844
Gene Symbol finder PHF5A
Protein Name PHD finger protein 5A
RefSeq NM_032758.3
Length of RefSeq (bp) 1105
Chromosome 22q13.2
Reference DDBJ accession
UniGene Hs.474980

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi55A03 pGCAP10 GATCCTGATTTGATCTTTTGCCGCAAGCAGGCTGGTGTTGCCATCGGAAGACTGTGTGAA
ARiS109J12 pGCAP10 GGGTGGCCGGCTTAGTTAGGAGCTATGGCTAAACATCATCCTGATTTGATCTTTTGCCGC
RBdS022N09 pGCAP10 GAGTTAGGAGCTATGGCTAAACATCATCCTGATTTGATCTTTTGCCGCAAGCAGGCTGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl