Prev. |  KEGG KO K12834 > 

RIKEN DNA Bank Human Resource - PHF5A

Gene ID NCBI Gene 84844 |  KEGG hsa:84844
Gene Symbol PHF5A
Protein Name PHD finger protein 5A
Synonyms INI|Rds3|SAP14b|SF3B7|SF3b14b|bK223H9.2
Ortholog resource in our bank

  PHF5A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX066769 IRAK166P09 pCMV-SPORT6 BC075808 NM_032758 Full
HGY081300 IRAL003E04 pOTB7 BC007321 NM_032758 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE035068 W01A087L04 pENTR-TOPO IRAL003E04 BC007321 NM_032758  
HGE035070 W01A087L06 pENTR-TOPO IRAL003E04 BC007321 NM_032758  
HGE035078 W01A087L14 pENTR-TOPO IRAL003E04 BC007321 NM_032758  
HGE035088 W01A087L24 pENTR-TOPO IRAL003E04 BC007321 NM_032758  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182003 ARi55A03 pGCAP10 NM_032758.3  
GATCCTGATTTGATCTTTTGCCGCAAGCAGGCTGGTGTTGCCATCGGAAGACTGTGTGAA
HKR243828 ARiS109J12 pGCAP10 NM_032758.3  
GGGTGGCCGGCTTAGTTAGGAGCTATGGCTAAACATCATCCTGATTTGATCTTTTGCCGC
HKR409121 RBdS022N09 pGCAP10 NM_032758.3  
GAGTTAGGAGCTATGGCTAAACATCATCCTGATTTGATCTTTTGCCGCAAGCAGGCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl