Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05782

HP ID(1) HP05782
Gene ID(2) 83439
Gene Symbol finder TCF7L1
Protein Name transcription factor 7-like 1 (T-cellspecific, HMG-box)
RefSeq NM_031283.1
Length of RefSeq (bp) 2779
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.516297

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd41E03 pGCAP10 GAGGGGCTGGGACGCCCCGGCGGAGCAGGNGGCGGCGGTGGCGAGTTGGGGAGCCCTCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl