Prev. |  KEGG KO K04490 > 

RIKEN DNA Bank Human Resource - TCF7L1

Gene ID NCBI Gene 83439 |  KEGG hsa:83439
Gene Symbol TCF7L1
Protein Name transcription factor 7 like 1
Synonyms TCF-3|TCF3
Ortholog resources KEGG ortholog (KEGG orthology K04490) in the DNA Bank
Featured content Hippo signaling (human)
Featured content Wnt signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX047881 IRAK119L17 pCMV-SPORT6 BC058894 NM_031283 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR376499 RBd41E03 pGCAP10 NM_031283.1  
GAGGGGCTGGGACGCCCCGGCGGAGCAGGNGGCGGCGGTGGCGAGTTGGGGAGCCCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl