Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05780

HP ID(1) HP05780
Gene ID(2) 10245
Gene Symbol finder TIMM17B
Protein Name translocase of inner mitochondrial membrane 17 homolog B (yeast)
RefSeq NM_005834.1
Length of RefSeq (bp) 960
Chromosome Xp11.23
Reference DDBJ accession
UniGene Hs.30570

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe75E04 pKA1U5 TTGGAGACGCCAGCGCCATGGAGGAGTACGCTCCGTTAGCCCTGCCCATGGCGAATTGTG
RBb31D05 pGCAP1 GAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATTGTGGATG
RBb51D08 pGCAP1 TGGCGGCCAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATT
RBd07B04 pGCAP10 CCCCAGGCTACCCCAGCTATCAGCAGTACCACTGAGGAAGCCACTGCCACCATGGGAGCT
RBd41B11 pGCAP10 GGCGCGGCCAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAAT
RBdS014M16 pGCAP10 GGGGGGCGTGGCCTGACTGCGCGGCCAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAG
RBdS154F14 pGCAP10 GAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATTGTGGATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl