Prev. |  KEGG KO K17795 > 

RIKEN DNA Bank Human Resource - TIMM17B

Gene ID NCBI Gene 10245 |  KEGG hsa:10245
Gene Symbol TIMM17B
Protein Name translocase of inner mitochondrial membrane 17B
Synonyms DXS9822|JM3|TIM17B
Ortholog resource in our bank

  TIMM17B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091138 IRAL027O02 pOTB7 BC010142 NM_005834 Full
HGY096622 IRAL041J06 pDNR-LIB BC029446 NM_005834 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004034 W01A010B10 pENTR-TOPO IRAL027O02 BC010142 NM_005834  
HGE004038 W01A010B14 pENTR-TOPO IRAL027O02 BC010142 NM_005834  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070100 ARe75E04 pKA1U5 NM_005834.1  
TTGGAGACGCCAGCGCCATGGAGGAGTACGCTCCGTTAGCCCTGCCCATGGCGAATTGTG
HKR332477 RBb31D05 pGCAP1 NM_005834.1  
GAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATTGTGGATG
HKR340480 RBb51D08 pGCAP1 NM_005834.1  
TGGCGGCCAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATT
HKR362828 RBd07B04 pGCAP10 NM_005834.1  
CCCCAGGCTACCCCAGCTATCAGCAGTACCACTGAGGAAGCCACTGCCACCATGGGAGCT
HKR376435 RBd41B11 pGCAP10 NM_005834.1  
GGCGCGGCCAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAAT
HKR405904 RBdS014M16 pGCAP10 NM_005834.1  
GGGGGGCGTGGCCTGACTGCGCGGCCAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAG
HKR461734 RBdS154F14 pGCAP10 NM_005834.1  
GAGACGCCAGCGCCATGGAGGAGTACGCTCGGGAGCCCTGCCCATGGCGAATTGTGGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl