Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05765

HP ID(1) HP05765
Gene ID(2) 55486
Gene Symbol finder PARL
Protein Name presenilin associated, rhomboid-like
RefSeq NM_018622.5
Length of RefSeq (bp) 1423
Chromosome 3q27.1
Reference DDBJ accession
UniGene Hs.478469

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd53F02 pGCAP10 GGGGAAGATGGCGTGGCGAGGCTGGGCGCAGAGAGGCTGGGGCTGCGGCCAGGCGTGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl