Prev. |  KEGG KO K09650 > 

RIKEN DNA Bank Human Resource - PARL

Gene ID NCBI Gene 55486 |  KEGG hsa:55486
Gene Symbol PARL
Protein Name presenilin associated rhomboid like
Synonyms PRO2207|PSARL|PSARL1|PSENIP2|RHBDS1
Ortholog resource in our bank

  PARL

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084510 IRAL011E14 pOTB7 BC003653 NM_001037639 Full
HGY091322 IRAL028F02 pOTB7 BC014058 NM_018622 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041211 W01A103A11 pENTR-TOPO IRAL028F02 BC014058 NM_018622  
HGE041215 W01A103A15 pENTR-TOPO IRAL028F02 BC014058 NM_018622  
HGE041217 W01A103A17 pENTR-TOPO IRAL028F02 BC014058 NM_018622  
HGE041219 W01A103A19 pENTR-TOPO IRAL028F02 BC014058 NM_018622  
HGE041223 W01A103A23 pENTR-TOPO IRAL028F02 BC014058 NM_018622  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR381322 RBd53F02 pGCAP10 NM_018622.5  
GGGGAAGATGGCGTGGCGAGGCTGGGCGCAGAGAGGCTGGGGCTGCGGCCAGGCGTGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl