Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05761

HP ID(1) HP05761
Gene ID(2) 10422
Gene Symbol finder UBAC1
Protein Name UBA domain containing 1
RefSeq NM_016172.2
Length of RefSeq (bp) 1877
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.9194

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075K15 pGCAP10 GAGGAGGAGAAGATCTTCGCGGGCAAGGTGCTGCGGCTGCACATCTGCGCGTCCGACGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl