Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075K15

Clone ID RBdS075K15
HP ID HP05761
Gene ID 10422
Gene Symbol UBAC1
Protein Name UBA domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_016172.2
Length of RefSeq (bp) 1877
Chromosome 9q34.3
Reference DDBJ accession
UniGene Hs.9194
5'-terminal sequence GAGGAGGAGAAGATCTTCGCGGGCAAGGTGCTGCGGCTGCACATCTGCGCGTCCGACGGC
2011.08.28