Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05758

HP ID(1) HP05758
Gene ID(2) 55658
Gene Symbol finder RNF126
Protein Name ring finger protein 126
RefSeq NM_194460.1
Length of RefSeq (bp) 1658
Chromosome 19p13.3
Reference DDBJ accession
UniGene Hs.69554

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARh09H05 pGCAP1 GGGGCGCGTCGGCCGGCGAGGGAGCAGCAAACGGCCGGCGGCGGGTGCCGCGCG
RBd22D04 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl