Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05723

HP ID(1) HP05723
Gene ID(2) 5546
Gene Symbol finder PRCC
Protein Name papillary renal cell carcinoma (translocation-associated)
RefSeq NM_005973.4
Length of RefSeq (bp) 2142
Chromosome 1q21.1
Reference DDBJ accession
UniGene Hs.516948

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS013I01 pGCAP10 GGGCCATTAGCTGTGNGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTG
ARiS085O15 pGCAP10 GGGCCATTAGCTGTGTGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTG
RBd13E06 pGCAP10 GATTAGCTGTGTGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTGTTCG
RBdS070F15 pGCAP10 GGCCATTAGCTGTGTGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTGT
RBdS075K17 pGCAP10 CCAGGCGTGGTGGCATGCGCCTGTAATCCCAGCTACTCGGGAGGCTGAGACAGGAGAATC
RBdS081D03 pGCAP10 GGGAAATCAGCCGTAGCCATGAGTTTCTGCCGGGGCTAGCCCTAGAGTACGGAGCAGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl