Prev. |  KEGG KO K13105 > 

RIKEN DNA Bank Human Resource - PRCC

Gene ID NCBI Gene 5546 |  KEGG hsa:5546
Gene Symbol PRCC
Protein Name papillary renal cell carcinoma (translocation-associated)
Synonyms RCCP1|TPRC
Ortholog resources KEGG ortholog (KEGG orthology K13105) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005008 IRAK012I16 pCMV-SPORT6 BC010450 NM_005973 Full/var
HGY084600 IRAL011I08 pOTB7 BC004913 NM_005973 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205393 ARiS013I01 pGCAP10 NM_005973.4  
GGGCCATTAGCTGTGNGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTG
HKR234351 ARiS085O15 pGCAP10 NM_005973.4  
GGGCCATTAGCTGTGTGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTG
HKR365302 RBd13E06 pGCAP10 NM_005973.4  
GATTAGCTGTGTGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTGTTCG
HKR428135 RBdS070F15 pGCAP10 NM_005973.4  
GGCCATTAGCTGTGTGTAGTTGCCCGGGACTAGGAGCTTAAGTGAAGAGGTACGCCTTGT
HKR430257 RBdS075K17 pGCAP10 NM_005973.4  
CCAGGCGTGGTGGCATGCGCCTGTAATCCCAGCTACTCGGGAGGCTGAGACAGGAGAATC
HKR432475 RBdS081D03 pGCAP10 NM_005973.4  
GGGAAATCAGCCGTAGCCATGAGTTTCTGCCGGGGCTAGCCCTAGAGTACGGAGCAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl