Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05720

HP ID(1) HP05720
Gene ID(2) 3785
Gene Symbol finder KCNQ2
Protein Name potassium voltage-gated channel, KQT-like subfamily, member 2
RefSeq NM_004518.3
Length of RefSeq (bp) 2905
Chromosome 20q13.3
Reference DDBJ accession
UniGene Hs.161851

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb63G10 pGCAP1 GGAGGTGGCCGCAGCGTCTCCGCGCGCGGCCCAAGCCCGGCAGGAGTGCGGAACCGCCGC
RBdS081C22 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl