Prev. | Human A to Z list > K > 

RIKEN DNA Bank Human Resource - KCNQ2

Gene ID (NCBI) 3785
Gene Symbol KCNQ2
Protein Name potassium voltage-gated channel subfamily Q member 2
Synonyms BFNC|EBN|EBN1|ENB1|HNSPC|KCNA11|KV7.2
Databases KEGG hsa:3785 |  NCBI Gene 3785
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04927)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR345354 RBb63G10 pGCAP1 NM_004518.3  
GGAGGTGGCCGCAGCGTCTCCGCGCGCGGCCCAAGCCCGGCAGGAGTGCGGAACCGCCGC
HKR432470 RBdS081C22 pGCAP10 NM_004518.3  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl