Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05690

HP ID(1) HP05690
Gene ID(2) 4756
Gene Symbol finder NEO1
Protein Name neogenin homolog 1 (chicken)
RefSeq NM_002499.2
Length of RefSeq (bp) 7057
Chromosome 15q22.3-q23
Reference DDBJ accession
UniGene Hs.388613

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe69D07 pKA1U5 GGGAGCAGCGGCGGCCGCGGGAGCCGAGCTTGCAGCGAGGGACCGGCTGAGGCGCGCGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl