Prev. |  KEGG KO K06766 > 

RIKEN DNA Bank Human Resource - NEO1

Gene ID NCBI Gene 4756 |  KEGG hsa:4756
Gene Symbol NEO1
Protein Name neogenin 1
Synonyms IGDCC2|NGN|NTN1R2
Ortholog resource in our bank

  NEO1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067679 ARe69D07 pKA1U5 NM_002499.4 full/var done
GGGAGCAGCGGCGGCCGCGGGAGCCGAGCTTGCAGCGAGGGACCGGCTGAGGCGCGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl