Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NEO1

Gene ID (NCBI) 4756
Gene Symbol NEO1
Protein Name neogenin 1
Synonyms IGDCC2|NGN|NTN1R2
Databases KEGG hsa:4756 |  NCBI Gene 4756
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06766)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067679 ARe69D07 pKA1U5 NM_002499.2 done
GGGAGCAGCGGCGGCCGCGGGAGCCGAGCTTGCAGCGAGGGACCGGCTGAGGCGCGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl