Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05687

HP ID(1) HP05687
Gene ID(2) 51741
Gene Symbol finder WWOX
Protein Name WW domain containing oxidoreductase
RefSeq NM_016373.1
Length of RefSeq (bp) 2264
Chromosome 16q23.3-q24.1
Reference DDBJ accession
UniGene Hs.461453

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe69C05 pKA1U5 TGAGCGGGAGTGAGTTCCTGAGCGAGTGGACCCGGCAGCGGGCGATAGGGGGGCCAGGTG
RBb25A11 pGCAP1 GAGCGGGAGTGAGTTCCTGAGCGAGTGGACCCGGCAGCGGGCGATAGGGGGGCCAGGTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl