Prev. |  KEGG KO K19329 > 

RIKEN DNA Bank Human Resource - WWOX

Gene ID NCBI Gene 51741 |  KEGG hsa:51741
Gene Symbol WWOX
Protein Name WW domain containing oxidoreductase
Synonyms D16S432E|EIEE28|FOR|FRA16D|HHCMA56|PRO0128|SCAR12|SDR41C1|WOX1
Ortholog resource in our bank

  WWOX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083467 IRAL008L03 pOTB7 BC003184 NM_130844 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067653 ARe69C05 pKA1U5 NM_016373.1  
TGAGCGGGAGTGAGTTCCTGAGCGAGTGGACCCGGCAGCGGGCGATAGGGGGGCCAGGTG
HKR330011 RBb25A11 pGCAP1 NM_016373.1  
GAGCGGGAGTGAGTTCCTGAGCGAGTGGACCCGGCAGCGGGCGATAGGGGGGCCAGGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl