Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05686

HP ID(1) HP05686
Gene ID(2) 80218
Gene Symbol finder NAT13
Protein Name N-acetyltransferase 13 (GCN5-related)
RefSeq NM_025146.1
Length of RefSeq (bp) 3576
Chromosome 3q13.2
Reference DDBJ accession
UniGene Hs.596074

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe69B08 pKA1U5 GGAAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGAGAG
ARe72F05 pKA1U5 GGAAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGAGAG
ARiS055P17 pGCAP10 GGAGAGACCCGAGTGCACGTGTGGAGAAGCGGCGGCACAAGCGCGGCGGCGGGAGACACT
RBb63H07 pGCAP1 TGGCGGAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGA
RBb65C10 pGCAP1 GAGGGGCGGGGTGAAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAG
RBd24G04 pGCAP10 AGGGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGAGAGACCCGAGTGCACGTGTG
RBdS014P19 pGCAP10 GACTCGACTCTCGCGGCCTTCGTTGCTCGCACAGCTCCCTGCCCAGGCTAGGAGGCCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl