Prev. |  KEGG KO K20793 > 

RIKEN DNA Bank Human Resource - NAA50

Gene ID NCBI Gene 80218 |  KEGG hsa:80218
Gene Symbol NAA50
Protein Name N-alpha-acetyltransferase 50, NatE catalytic subunit
Synonyms MAK3|NAT13|NAT13P|NAT5|NAT5P|SAN|hNaa50p
Ortholog resource in our bank

  NAA50

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089613 IRAL024A13 pOTB7 BC012731 NM_025146 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067632 ARe69B08 pKA1U5 NM_025146.1  
GGAAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGAGAG
HKR068925 ARe72F05 pKA1U5 NM_025146.1  
GGAAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGAGAG
HKR222377 ARiS055P17 pGCAP10 NM_025146.1  
GGAGAGACCCGAGTGCACGTGTGGAGAAGCGGCGGCACAAGCGCGGCGGCGGGAGACACT
HKR345375 RBb63H07 pGCAP1 NM_025146.1  
TGGCGGAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGA
HKR346058 RBb65C10 pGCAP1 NM_025146.1  
GAGGGGCGGGGTGAAAGGTCACAGCGCGGCAGCGGGTCTGGCTGGCGGCAGCGGCGGGAG
HKR369748 RBd24G04 pGCAP10 NM_025146.1  
AGGGCGGGTCTGGCTGGCGGCAGCGGCGGGAGGGAGCCGAGAGACCCGAGTGCACGTGTG
HKR405979 RBdS014P19 pGCAP10 NM_025146.1  
GACTCGACTCTCGCGGCCTTCGTTGCTCGCACAGCTCCCTGCCCAGGCTAGGAGGCCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl