Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05682

HP ID(1) HP05682
Gene ID(2) 51490
Gene Symbol finder C9orf114
Protein Name chromosome 9 open reading frame 114
RefSeq NM_016390.2
Length of RefSeq (bp) 1891
Chromosome 9q34.11
Reference DDBJ accession
UniGene Hs.224137

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe68E03 pKA1U5 GGGTGTGTGCGGAACATGGCGGAGCGCGGCAGGAAGCGGCCGTGCGGCCCGGGTGAACAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl