Prev. |  KEGG KO K09142 > 

RIKEN DNA Bank Human Resource - SPOUT1

Gene ID NCBI Gene 51490 |  KEGG hsa:51490
Gene Symbol SPOUT1
Protein Name SPOUT domain containing methyltransferase 1
Synonyms C9orf114|CENP-32|CENP32|HSPC109
Ortholog resource in our bank

  SPOUT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005107 IRAK012M19 pCMV-SPORT6 BC010579 NM_016390 Full/var
HGX027445 IRAK068K05 pCMV-SPORT6 BC033677 NM_016390 Full/var
HGX047880 IRAK119L16 pCMV-SPORT6 BC056890 NM_016390 Full/var
HGX053883 IRAK134L19 pCMV-SPORT6 BC063644 NM_016390 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095628 M01C039B04 pDONR221 MGC09-D02 BC063644 NM_016390  
HGE095676 M01C039D04 pDONR221 MGC09-D02 BC063644 NM_016390  
HGE095724 M01C039F04 pDONR221 MGC09-D02 BC063644 NM_016390  
HGE095772 M01C039H04 pDONR221 MGC09-D02 BC063644 NM_016390  
HGE095820 M01C039J04 pDONR221 MGC09-D02 BC063644 NM_016390  
HGE095868 M01C039L04 pDONR221 MGC09-D02 BC063644 NM_016390  
HGE095916 M01C039N04 pDONR221 MGC09-D02 BC063644 NM_016390  
HGE095964 M01C039P04 pDONR221 MGC09-D02 BC063644 NM_016390  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067299 ARe68E03 pKA1U5 NM_016390.2  
GGGTGTGTGCGGAACATGGCGGAGCGCGGCAGGAAGCGGCCGTGCGGCCCGGGTGAACAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl