Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05674

HP ID(1) HP05674
Gene ID(2) 10630
Gene Symbol finder PDPN
Protein Name podoplanin
RefSeq NM_006474.4
Length of RefSeq (bp) 2828
Chromosome 1p36.21
Reference DDBJ accession
UniGene Hs.468675

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe67G07 pKA1U5 AGAGCCCGAGGGCGGGCCTAGCGCGCCCGGACGGAGACCACCTTGCGGCCGACCCCGCTC
ARi22B09 pGCAP10 TTGGAGTAGCGCGCCCGGACGGAGACCACCTTGCGGCCGACCCCGCTCCCCCGCCTCCTC
ARi61E01 pGCAP10 GACAGCCTAACGCTCTTCGCTGTCGTTTGCGGTCTCGCGCAGGGCGGCCCCGGTTCTGGT
ARi61E02 pGCAP10 GAACTGCAAAGTTTGCTGTCCGGCTGCCTAGGGTCTGGGAAGCTCGGGCACCCTCCCTCT
RBd31D04 pGCAP10 GAACTGCAAAGTTTGCTGTCCGGCTGCCTAGGGTCTGGGAAGCTCGGGCACCCTCCCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl