Prev. |  KEGG KO K16778 > 

RIKEN DNA Bank Human Resource - PDPN

Gene ID NCBI Gene 10630 |  KEGG hsa:10630
Gene Symbol PDPN
Protein Name podoplanin
Synonyms AGGRUS|GP36|GP40|Gp38|HT1A-1|OTS8|PA2.26|T1A|T1A-2|T1A2|TI1A
Ortholog resource in our bank

  PDPN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093908 IRAL034M20 pOTB7 BC014668 NM_001006625 Partial/var
HGY096994 IRAL042I02 pOTB7 BC022812 NM_001006625 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100813 M01C052A13 pDONR221 MGC15-E07 BC014668 NM_006474  
HGE100861 M01C052C13 pDONR221 MGC15-E07 BC014668 NM_006474  
HGE100909 M01C052E13 pDONR221 MGC15-E07 BC014668 NM_006474  
HGE100957 M01C052G13 pDONR221 MGC15-E07 BC014668 NM_006474  
HGE101005 M01C052I13 pDONR221 MGC15-E07 BC014668 NM_006474  
HGE101053 M01C052K13 pDONR221 MGC15-E07 BC014668 NM_006474  
HGE101101 M01C052M13 pDONR221 MGC15-E07 BC014668 NM_006474  
HGE101149 M01C052O13 pDONR221 MGC15-E07 BC014668 NM_006474  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066951 ARe67G07 pKA1U5 NM_006474.4  
AGAGCCCGAGGGCGGGCCTAGCGCGCCCGGACGGAGACCACCTTGCGGCCGACCCCGCTC
HKR168833 ARi22B09 pGCAP10 NM_006474.4  
TTGGAGTAGCGCGCCCGGACGGAGACCACCTTGCGGCCGACCCCGCTCCCCCGCCTCCTC
HKR184497 ARi61E01 pGCAP10 NM_006474.4  
GACAGCCTAACGCTCTTCGCTGTCGTTTGCGGTCTCGCGCAGGGCGGCCCCGGTTCTGGT
HKR184498 ARi61E02 pGCAP10 NM_006474.4  
GAACTGCAAAGTTTGCTGTCCGGCTGCCTAGGGTCTGGGAAGCTCGGGCACCCTCCCTCT
HKR372476 RBd31D04 pGCAP10 NM_006474.4  
GAACTGCAAAGTTTGCTGTCCGGCTGCCTAGGGTCTGGGAAGCTCGGGCACCCTCCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl