Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05673

HP ID(1) HP05673
Gene ID(2) 25898
Gene Symbol finder RCHY1
Protein Name ring finger and CHY zinc finger domain containing 1
RefSeq NM_015436.2
Length of RefSeq (bp) 4336
Chromosome 4q21.1
Reference DDBJ accession
UniGene Hs.48297

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe67F11 pKA1U5 GGTGAGGGGAGGTGGAGGAGATGGCGGCGACNCCNTNGGAAGATGGCGCCAGCGGTCAAG
ARiS150O09 pGCAP10 GGGATCGGTGGAATGTGANGGGAGGTGGANGANNNGGTNNAACNTCTGAGANNNNNNNTN
RBdS105P12 pGCAP10 GAGGATCGGTGGAATGTGAGGGGAGGTGGAGGAGATGGCGGCGACGGCCCGGGAAGATGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl