Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05658

HP ID(1) HP05658
Gene ID(2) 9678
Gene Symbol finder PHF14
Protein Name PHD finger protein 14
RefSeq NM_014660.2
Length of RefSeq (bp) 4259
Chromosome 7p21.3
Reference DDBJ accession
UniGene Hs.655688

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66H09 pKA1U5 GGTCGCTGCTTTCCCTATTGTCTGAGGCAGCCGCCCTCGCGCTGTGCAATTTCTGGTCTT
RBd79H02 pGCAP10 GTCCCTATTGTCTGAGGCAGCCGCCCTCGCGCTGTGCAATTTCTGGTCTTTCGTTGCTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl