Prev. | 

RIKEN DNA Bank Human Resource - PHF14

Gene ID NCBI Gene 9678 |  KEGG hsa:9678
Gene Symbol PHF14
Protein Name PHD finger protein 14
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066577 ARe66H09 pKA1U5 NM_014660.2  
GGTCGCTGCTTTCCCTATTGTCTGAGGCAGCCGCCCTCGCGCTGTGCAATTTCTGGTCTT
HKR391770 RBd79H02 pGCAP10 NM_014660.2  
GTCCCTATTGTCTGAGGCAGCCGCCCTCGCGCTGTGCAATTTCTGGTCTTTCGTTGCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl