Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05657

HP ID(1) HP05657
Gene ID(2) 65264
Gene Symbol finder UBE2Z
Protein Name ubiquitin-conjugating enzyme E2Z
RefSeq NM_023079.3
Length of RefSeq (bp) 3101
Chromosome 17q21.32
Reference DDBJ accession
UniGene Hs.514297

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66H07 pKA1U5 GGACACTCTGGCCCGGTTCTCGGTGGTGCGGGAGCGGGCGGGAGCAGCGGCCGCTCTGGT
ARe73C09 pKA1U5 GGACACTCTGGCCCGGTTCTCGGATGGTTGCGGGCNCCGTTNCGGGAGCAGCGGCCGCTC
RBd63D02 pGCAP10 TGGCCGGCCGATTGGGGCGGGAGCAGCGGCCGCTCTGGTCGGCGGACGTGCTGCCGAGTA
RBdS154P14 pGCAP10 GGAAGCAGCGATGGCGGAGAGTCCGACTGAGGAGGCGGCAACGGCGGGCGCCGGGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl