Prev. |  KEGG KO K10585 > 

RIKEN DNA Bank Human Resource - UBE2Z

Gene ID NCBI Gene 65264 |  KEGG hsa:65264
Gene Symbol UBE2Z
Protein Name ubiquitin conjugating enzyme E2 Z
Synonyms HOYS7|USE1
Ortholog resources KEGG ortholog (KEGG orthology K10585) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005854 IRAK014K14 pCMV-SPORT6 BC015169 NM_023079 Partial
HGX006242 IRAK015K02 pCMV-SPORT6 BC015890 NM_023079

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066575 ARe66H07 pKA1U5 NM_023079.3  
GGACACTCTGGCCCGGTTCTCGGTGGTGCGGGAGCGGGCGGGAGCAGCGGCCGCTCTGGT
HKR069257 ARe73C09 pKA1U5 NM_023079.3  
GGACACTCTGGCCCGGTTCTCGGATGGTTGCGGGCNCCGTTNCGGGAGCAGCGGCCGCTC
HKR385274 RBd63D02 pGCAP10 NM_023079.3  
TGGCCGGCCGATTGGGGCGGGAGCAGCGGCCGCTCTGGTCGGCGGACGTGCTGCCGAGTA
HKR461974 RBdS154P14 pGCAP10 NM_023079.3  
GGAAGCAGCGATGGCGGAGAGTCCGACTGAGGAGGCGGCAACGGCGGGCGCCGGGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl