Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05654

HP ID(1) HP05654
Gene ID(2) 56255
Gene Symbol finder TXNDC13
Protein Name thioredoxin domain containing 13
RefSeq NM_021156.2
Length of RefSeq (bp) 2368
Chromosome 20p12
Reference DDBJ accession
UniGene Hs.169358

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66G06 pKA1U5 GGAGCACCGCCAGTCTGCGCCGCTAGGCGTAGGCGGGGATGGCCCTTGCGTCTCCCGCTT
ARi26B12 pGCAP10 GGAGCACCGCCAGTCTGCGCCGCTAGGCGTAGGCGGGGTGGCCCTTGCGTCTCCCGCTTC
RBdS083A16 pGCAP10 GGCTCGGCGCCCAACATGGCGGGTGGGCGCTGCGGCCCGCAGCTAACGGCGCTCCTGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl