Prev. | 

RIKEN DNA Bank Human Resource - TMX4

Gene ID NCBI Gene 56255 |  KEGG hsa:56255
Gene Symbol TMX4
Protein Name thioredoxin related transmembrane protein 4
Synonyms DJ971N18.2|PDIA14|TXNDC13
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027373 IRAK068H05 pCMV-SPORT6 BC033787 NM_021156 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066550 ARe66G06 pKA1U5 NM_021156.2  
GGAGCACCGCCAGTCTGCGCCGCTAGGCGTAGGCGGGGATGGCCCTTGCGTCTCCCGCTT
HKR170436 ARi26B12 pGCAP10 NM_021156.2  
GGAGCACCGCCAGTCTGCGCCGCTAGGCGTAGGCGGGGTGGCCCTTGCGTCTCCCGCTTC
HKR433216 RBdS083A16 pGCAP10 NM_021156.2  
GGCTCGGCGCCCAACATGGCGGGTGGGCGCTGCGGCCCGCAGCTAACGGCGCTCCTGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl