Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05653

HP ID(1) HP05653
Gene ID(2) 6046
Gene Symbol finder BRD2
Protein Name bromodomain containing 2
RefSeq NM_005104.3
Length of RefSeq (bp) 4907
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.75243

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66E12 pKA1U5 GGTCTGCGGCAGCCATGCTGAACTCGTATGGAGAGGCGAGTGGGGGGGACAGAGTCCAGG
RBd49B09 pGCAP10 GGCCATTTCGTGCTGGAGTGGAGCAGCCTCTAGAACGAGCTGGAGGATTCTGCCTACCGA
RBdS014H03 pGCAP10 GCTCCTCCGCTCGCCCTCCTCCCTGGCGCTGACCGATGGACCAGCCGCTCCGTGGGGAGG
RBdS014O24 pGCAP10 GCTCCTCCGCTCGCCCTCCTCCCTGGCGCTGACCGATGGACCAGCCGCTCCGTGGGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl