Prev. |  KEGG KO K08871 > 

RIKEN DNA Bank Human Resource - BRD2

Gene ID NCBI Gene 6046 |  KEGG hsa:6046
Gene Symbol BRD2
Protein Name bromodomain containing 2
Synonyms BRD2-IT1|D6S113E|FSH|FSRG1|NAT|O27.1.1|RING3|RNF3
Ortholog resources KEGG ortholog (KEGG orthology K08871) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB12841 Histac-K12 pcDNA3.1 For the detection of acetylation at the 12th lysine residues of histone H4 by the BRD2 bromodomain.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056458 IRAK141C10 pCMV-SPORT6 BC063840 NM_005104 Full/var
HGY080731 IRAL001N19 pOTB7 BC000477 NM_005104 Partial/var
HGY087139 IRAL017O03 pOTB7 BC007715 NM_005104 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE039181 W01A097P21 pENTR-TOPO IRAK141C10 BC063840 NM_005104  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066508 ARe66E12 pKA1U5 NM_005104.3  
GGTCTGCGGCAGCCATGCTGAACTCGTATGGAGAGGCGAGTGGGGGGGACAGAGTCCAGG
HKR379633 RBd49B09 pGCAP10 NM_005104.3  
GGCCATTTCGTGCTGGAGTGGAGCAGCCTCTAGAACGAGCTGGAGGATTCTGCCTACCGA
HKR405771 RBdS014H03 pGCAP10 NM_005104.3  
GCTCCTCCGCTCGCCCTCCTCCCTGGCGCTGACCGATGGACCAGCCGCTCCGTGGGGAGG
HKR405960 RBdS014O24 pGCAP10 NM_005104.3  
GCTCCTCCGCTCGCCCTCCTCCCTGGCGCTGACCGATGGACCAGCCGCTCCGTGGGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl