Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05648

HP ID(1) HP05648
Gene ID(2) 23659
Gene Symbol finder PLA2G15
Protein Name phospholipase A2, group XV
RefSeq NM_012320.3
Length of RefSeq (bp) 2764
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.632199

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66A12 pKA1U5 GAGAGCTGAACCTGCATCCCGGACCTGCGGCGACCGTCGTACACCATGGGCCTCCACCTC
RBdS013P02 pGCAP10 GGAGCTGAACCTGCATCCCGGACCTGCGGCGACCGTCGTACACCATGGGCCTCCACCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl