Prev. |  KEGG KO K06129 > 

RIKEN DNA Bank Human Resource - PLA2G15

Gene ID NCBI Gene 23659 |  KEGG hsa:23659
Gene Symbol PLA2G15
Protein Name phospholipase A2 group XV
Synonyms ACS|GXVPLA2|LLPL|LPLA2|LYPLA3
Featured content Lysosome (human)
Ortholog resource in our bank

  PLA2G15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086951 IRAL017G07 pOTB7 BC011640 NM_012320 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066412 ARe66A12 pKA1U5 NM_012320.3  
GAGAGCTGAACCTGCATCCCGGACCTGCGGCGACCGTCGTACACCATGGGCCTCCACCTC
HKR405562 RBdS013P02 pGCAP10 NM_012320.3  
GGAGCTGAACCTGCATCCCGGACCTGCGGCGACCGTCGTACACCATGGGCCTCCACCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl