Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05617

HP ID(1) HP05617
Gene ID(2) 9060
Gene Symbol finder PAPSS2
Protein Name 3'-phosphoadenosine 5'-phosphosulfate synthase 2
RefSeq NM_004670.3
Length of RefSeq (bp) 3859
Chromosome 10q23-q24
Reference DDBJ accession
UniGene Hs.524491

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe62B07 pKA1U5 GGAAGGGGGCTGGTCAAGGGAAGTGCGACGTGTCTGCGGAGCCTTTTTATACCTCCTTCC
ARe67C04 pKA1U5 GAGCCGCTGCTGCTGCTGCTGCTGCTGCTGCCGCCGCCGCCGCCGCCGTCCCTGCGTCCT
ARe92D10 pKA1U5 GNCCCGGGCACNGNGGCTGGTCNGAGCGCGCGCCCGCGTATCTATGGGCCGGGCCGGGGA
ARiS087K04 pGCAP10 GAGCCGCTGCTGCTGCTGCTGCTGCTGCTGCCGCCGCCGCCGCCGCCGTCCCTGCGTCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl