Prev. |  KEGG KO K13811 > 

RIKEN DNA Bank Human Resource - PAPSS2

Gene ID NCBI Gene 9060 |  KEGG hsa:9060
Gene Symbol PAPSS2
Protein Name 3'-phosphoadenosine 5'-phosphosulfate synthase 2
Synonyms ATPSK2|BCYM4|SK2
Ortholog resources KEGG ortholog (KEGG orthology K13811) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081577 IRAL003P17 pOTB7 BC009894 NM_004670 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064831 ARe62B07 pKA1U5 NM_004670.3  
GGAAGGGGGCTGGTCAAGGGAAGTGCGACGTGTCTGCGGAGCCTTTTTATACCTCCTTCC
HKR066852 ARe67C04 pKA1U5 NM_004670.3  
GAGCCGCTGCTGCTGCTGCTGCTGCTGCTGCCGCCGCCGCCGCCGCCGTCCCTGCGTCCT
HKR076882 ARe92D10 pKA1U5 NM_004670.3  
GNCCCGGGCACNGNGGCTGGTCNGAGCGCGCGCCCGCGTATCTATGGGCCGGGCCGGGGA
HKR235044 ARiS087K04 pGCAP10 NM_004670.3  
GAGCCGCTGCTGCTGCTGCTGCTGCTGCTGCCGCCGCCGCCGCCGCCGTCCCTGCGTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl