Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05616

HP ID(1) HP05616
Gene ID(2) 60314
Gene Symbol finder C12orf10
Protein Name chromosome 12 open reading frame 10
RefSeq NM_021640.3
Length of RefSeq (bp) 1215
Chromosome 12q13
Reference DDBJ accession
UniGene Hs.655988

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe62A10 pKA1U5 GGGGTCGGCGCTCCTGCCTCCCTGCAGGGAGCTGCTTATGGGACACCGCTTCCTGCGCGG
ARe89E05 pKA1U5 GGGGTCGGCGCTCCTGCCTCCCTGCAGGGAGCTGCTTATGGGACACCGCTTCCTGCGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl