Prev. | 

RIKEN DNA Bank Human Resource - C12orf10

Gene ID NCBI Gene 60314 |  KEGG hsa:60314
Gene Symbol C12orf10
Protein Name chromosome 12 open reading frame 10
Synonyms Gamm1|MST024|MSTP024|MYG|MYG1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011626 IRAK029B02 pCMV-SPORT6 BC028904 NM_021640 Partial/var
HGX044036 IRAK110B12 pCMV-SPORT6 BC051871 NM_021640 Full
HGY082866 IRAL007C18 pOTB7 BC013956 NM_021640 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064810 ARe62A10 pKA1U5 NM_021640.3  
GGGGTCGGCGCTCCTGCCTCCCTGCAGGGAGCTGCTTATGGGACACCGCTTCCTGCGCGG
HKR075701 ARe89E05 pKA1U5 NM_021640.3  
GGGGTCGGCGCTCCTGCCTCCCTGCAGGGAGCTGCTTATGGGACACCGCTTCCTGCGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl