Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP05615

HP ID(1) HP05615
Gene ID(2) 55754
Gene Symbol finder TMEM30A
Protein Name transmembrane protein 30A
RefSeq NM_018247.3
Length of RefSeq (bp) 4544
Chromosome 6q14.1
Reference DDBJ accession
UniGene Hs.108530

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe61F11 pKA1U5 GGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGCCNTTNAGCGGCGCTCGAGCGGTTCCTG
ARi31D04 pGCAP10 GGGAGGTGGCTGTGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGGCGGCAGCGGCGCTCG
ARi35F05 pGCAP10 GGAGCGGTTCCTGTCAGGGTCAGCCGGCGGGCCCCCTGGGTGGTCCACCTGCAAATCGCG
ARiS191E03 pGCAP10 GGCTCTACNNCGGAGGTGGCTGTGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGGCGGCA
RBdS051F10 pGCAP10 GGTGGCTGTGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGGCGGCAGCGGCGCTCGAGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl