DNA Bank Top |  KEGG KO K26935 > 

RIKEN DNA Bank Human Resource - TMEM30A

Gene ID NCBI Gene 55754 |  KEGG hsa:55754
Gene Symbol TMEM30A
Protein Name transmembrane protein 30A
Synonyms C6orf67|CDC50A

Link

Ortholog resource in our bank

  TMEM30A

External database

human TMEM30A

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20145 pcDNA3/HF-CDC50A Expression vector of human CDC50A for mammalian cells, N-terminal His6-Flag-tag. NM_018247.4 full cds

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007686 IRAK019D14 pCMV-SPORT6 BC009006 NM_018247 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064531 ARe61F11 pKA1U5 NM_018247.3  
GGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGCCNTTNAGCGGCGCTCGAGCGGTTCCTG
HKR172476 ARi31D04 pGCAP10 NM_018247.3  
GGGAGGTGGCTGTGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGGCGGCAGCGGCGCTCG
HKR174125 ARi35F05 pGCAP10 NM_018247.3  
GGAGCGGTTCCTGTCAGGGTCAGCCGGCGGGCCCCCTGGGTGGTCCACCTGCAAATCGCG
HKR276499 ARiS191E03 pGCAP10 NM_018247.3  
GGCTCTACNNCGGAGGTGGCTGTGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGGCGGCA
HKR420530 RBdS051F10 pGCAP10 NM_018247.3  
GGTGGCTGTGGCGGTGGCGCTGGTGGCTGCGGCGGCGGCGGCGGCAGCGGCGCTCGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl